NEB PCR Cloning Kit from New England Biolabs

Product Specs
ItemNEB PCR Cloning Kit
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberE1202S
Quantity20 reactions
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TemperatureMulti-Temperature

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) PCR cloning Intermediated Gibson assembly (PIG) for Constructing DNA Repair Templates in CRISPR-Cas9 Based Gene EditingMicroPubl BiolAugust 18, 2023Dongsheng Han, Scott Churcher, Jared T. Nordmanprimer,TCAGGGTTATTGTCTCATGAGCG pScarlessHD-sfGFP-DsRed,Addgene #80811 NEB Q5® High-Fidelity 2X Master Mix,M0494 NEB® PCR Cloning Kit,E1202S NEB Gibson Assembly® Master Mix,E2611S SYBR™ Safe DNA gel stain,S33102 NEB® 1 kb DNA ladder,N3232S TOYOBO

(2) Mini-PCDH15 gene therapy rescues hearing in a mouse model of Usher syndrome type 1FNature CommunicationsApril 26, 2023Maryna V. Ivanchenko, Daniel M. Hathaway, Alex J. Klein, Bifeng Pan, Olga Strelkova, Pedro De-la-Torre, Xudong Wu, Cole W. Peters, Eric M. Mulhall, Kevin T. Booth, et al.purified PCR products were cloned into the pMiniT 2.0 vector backbone using the NEB PCR Cloning Kit (NEB, #E1202S), and transformed into competent cells. Three colonies were mini-prepped for each product and each was

(3) STRAIGHT-IN enables high-throughput targeting of large DNA payloads in human pluripotent stem cellsCell Rep MethodsOctober 24, 2022Blanch-Asensio A, Grandela C, Brandão KO, de Korte T, Mei H, Ariyurek Y, Yiangou L, Mol MPH, van Meer BJ, Kloet SL, et al.NEBuilder® HiFi DNA Assembly Cloning kit,New England Biolabs,Cat#E5520S NEB® PCR Cloning Kit,New England Biolabs,Cat#E1202S ddPCR Supermix for Probes (no dUTP),Bio-Rad,Cat#1863024 QuickExtract™,Biosearch Technologies,Cat#QE905T High Pure PCR Template Preparation Kit

(4) Independent regulation of mitochondrial DNA quantity and quality in Caenorhabditis elegans primordial germ cellseLifeOctober 6, 2022Aaron Z A Schwartz, Nikita Tsyba, Yusuff Abdu, Maulik R Patel, Jeremy NancemtDNA containing nd-1 was amplified by PCR and cloned into pMiniT2.0 using the NEB PCR cloning kit (NEB E1202S). The purified plasmid was linearized with BamHI-HF (NEB 3136), and DNA concentration was quantified

(5) Genetic variation in ALDH4A1 is associated with muscle health over the lifespan and across specieseLifeApril 26, 2022Osvaldo Villa, Nicole L Stuhr, Chia-an Yen, Eileen M Crimmins, Thalida Em Arpawong, Sean P Curranalh-6(lax947);gst-4p::gfp Sequence-based reagent,pMiniT 2.0 vector and cloning kit,New England Biolabs,#E1202S, "Software, algorithm",MBF BioscienceWormlab,https://www.mbfbioscience.com/wormlab,, Other,US Health

(6) Cavin4 interacts with Bin1 to promote T-tubule formation and stability in developing skeletal muscleJournal of Cell BiologyDecember 6, 2021Harriet P. Lo et al.plate. Genomic sequence of isolated clones at targeting locus were further confirmed by PCR cloning (#E1202S; NEB) and Sanger sequencing (Australian Genome Research Facility, The University of Queensland). A single

(7) The analysis of GSTA1 promoter genetic and functional diversity of human populationsScientific ReportsDecember 1, 2021Vid Mlakar et al.the case of ambiguous diplotype, PCR products were TOPO TA cloned using linearized pMiniT 2.0 vector (E1202S, New England Biolabs, USA) according to manufacturer’s recommendations. Several colonies were picked

(8) Evaluating functional ligand-GPCR interactions in cell-based assaysBiomolecular Interactions Part ANovember 9, 2021Sheryl Sharma, James W. CheccoOptional: S.O.C. medium (ThermoFisher, 15544034). Optional: PCR cloning kit (New England Biolabs, E1202S). Optional: Plasmid DNA Maxi-prep kit (e.g., E.Z.N.A. Plasmid Maxi kit, Omega Biotek, D6922-02). 3.2.2

(9) Extracellular LGALS3BP regulates neural progenitor position and relates to human cortical complexityNature communicationsNovember 2, 2021Kyrousi C, O'Neill AC, Brazovskaja A, He Z, Kielkowski P, Coquand L, Di Giaimo R, D' Andrea P, Belka A, Forero Echeverry A, et al.5. The resulting PCR product (644 bp) was cloned and Sanger sequenced using the NEB PCR Cloning Kit (E1202S, NEB) to screen the individual genomic alleles. The manufacturer’s recommendations/kit protocols were

(10) Disrupting the ghrelin-growth hormone axis limits ghrelin's orexigenic but not glucoregulatory actionsMolecular MetabolismNovember 1, 2021Deepali Gupta, Anna M. Patterson, Sherri Osborne-Lawrence, Angie L. Bookout, Salil Varshney, Kripa Shankar, Omprakash Singh, Nathan P. Metzger, Corine P. Richard, Steven C. Wyler, et al.sites were included on each end. This entire fragment was cloned using an NEB PCR cloning kit (cat.# E1202S, New England Biolabs, Ipswich, MA, USA) vector backbone. The construct was digested with NB.BbvC1 (which

(11) Feeding-dependent tentacle development in the sea anemone Nematostella vectensisNature communicationsSeptember 2, 2020Ikmi A, Steenbergen PJ, Anzo M, McMullen MR, Stokkermans A, Ellington LR, Gibson MC.products showing overlapping peaks in their chromatograms were cloned using NEB PCR cloning kit (NEB #E1202S) and then sequenced to define the identity of mutations carried by F1 heterozygous animals. For each

(12) Production of transgenic Paulownia tomentosa (Thunb.) steud. using chitosan nanoparticles to express antimicrobial genes resistant to bacterial infectionMol Biol Res CommunAugust 18, 2020Eman Tawfik Hussienpurified Thio-60 and Thio-63 product were ligated separately to pMiniT vector (NEB® PCR Cloning Kit, #E1202S. The kit was supplied with NEB 10-beta competent E.coli (NEB #C3019)) following the manual instruction

(13) ECE2 regulates neurogenesis and neuronal migration during human cortical developmentEMBO reportsMay 6, 2020Buchsbaum IY, Kielkowski P, Giorgio G, O'Neill AC, Di Giaimo R, Kyrousi C, Khattak S, Sieber SA, Robertson SP, Cappello S.above‐mentioned primer pair. The resulting PCR product (906 bp) was cloned using NEB PCR Cloning Kit (#E1202S; NEB) and Sanger‐sequenced to screen the individual genomic alleles. All the Sanger sequencing was performed

(14) Cacna1b alternative splicing impacts excitatory neurotransmission and is linked to behavioral responses to aversive stimuliMolecular BrainDecember 1, 2019Alexandra Bunda, Brianna LaCarubba, Melanie Bertolino, Marie Akiki, Kevin Bath, Javier Lopez-Soto, Diane Lipscombe, Arturo Andrade[37]. To confirm band identity, all bands were cloned and sequenced using NEB® PCR Cloning Kit (NEB, E1202S). End-point PCR was performed to validate the specificity of primers directed to 37a (Fig. 6c). We used

(15) Disordered breathing in a mouse model of Dravet syndromeeLifeApril 26, 2019Kuo FS, Cleary CM, LoTurco JJ, Chen X, Mulkey DK.the linearized pMiniT 2.0 vector using the NEB PCR cloning kit and NEB 10-beta competent cells (Cat E1202S). The resulting transformed competent cells were then streaked out onto LB agar plates with ampicillin

(16) Aedes aegypti Mosquitoes Detect Acidic Volatiles Found in Human Odor Using the IR8a PathwayCurrent BiologyApril 1, 2019Joshua I. Raji, Nadia Melo, John S. Castillo, Sheyla Gonzalez, Valeria Saldana, Marcus C. Stensmyr, Matthew DeGennaro(Catalog #740609, Machery-Nagel Inc., Bethlehem, PA, USA), cloned using the NEB PCR cloning kit (Catalog #E1202S, New England Biolabs) and Sanger sequenced using the SimpleSeq premixed Kit (Eurofins Genomics) with

(17) Fluorescent labeling of CRISPR/Cas9 RNP for gene knockout in HSPCs and iPSCs reveals an essential role for GADD45b in stress responseBlood AdvancesJanuary 8, 2019Masoud Nasri, Perihan Mir, Benjamin Dannenmann, Diana Amend, Tessa Skroblyn, Yun Xu, Klaus Schulze-Osthoff, Maksim Klimiankou, Karl Welte, Julia Skokowa28706; Qiagen) and cloned into the linearized pMiniT 2.0 vector using the NEB PCR Cloning Kit (cat. no. E1202S; New England Biolabs) followed by transformation of competent Escherichia coli and subsequent colony PCR

(18) Bazı Lysiphlebus confusus Tremblay & Eady (Hymenoptera: Braconidae: Aphidiinae) popülasyonlarında genetik çeşitlilikTürkiye Biyolojik Mücadele DergisiDecember 28, 2018Gül Satar, Petek Tokluaccording to the Qiagen gel purification instructions. The PCR product was then inserted into the vector E1202S (NEB, USA) and cloned into E. coli. For plasmid purification, a Wizard Plus SV Minipreps DNA purification

(19) Loss of SETDB1 decompacts the inactive X chromosome in part through reactivation of an enhancer in the IL1RAPL1 geneEpigenetics & ChromatinDecember 1, 2018Zhuo Sun, Brian P. Chadwickwith primers that incorporate a 5′ SalI and 3′ BamHI site before cloning into pMiniT2.0 (NEB, Cat. No. E1202S). Clones were verified to be free of PCR-induced mutations before subcloning into the SalI-BamHI sites

(20) Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?NanotheranosticsJanuary 1, 2018Paramonov VM, Desai D, Kettiger H, Mamaeva V, Rosenholm JM, Sahlgren C, Rivero-Müller A.coding sequences were cloned into linearized pMiniT plasmid (New England Biolabs' PCR cloning kit, Cat#E1202S) as suggested by the provider. The ligation products were used for transformation of 10-beta chemically

Be the First to Write a Review!

Related Products

Item	Catalog Number	Get Quote	More Info
Gibson Assembly Cloning Kit	E5510S	Supplier Page	Website
Q5 Site-Directed Mutagenesis Kit	E0554S	Supplier Page	Website
Instant Sticky-end Ligase Master Mix	M0370L	Supplier Page	Website
Shrimp Alkaline Phosphatase (rSAP)	M0371L	Supplier Page	Website
USEREnzyme	M5505L	Supplier Page	Website
Quick-LoadPurple 1 kb Plus DNA Ladder	N0550S	Supplier Page	Website
NEB Stable Competent E. coli (High Efficiency)	C3040H	Supplier Page	Website
NEB 10-beta Competent E. coli (High Efficiency)	C3019I	Supplier Page	Website
NEB 5-alpha Competent E. coli (High Efficiency)	C2987I	Supplier Page	Website